Summary of Contents for Clontech PT3139-1
- Page 1 ® Advantage -HF PCR Kit User Manual (PT3139-1) Catalog #K1909-1, -y ° Storage conditions: –20 FOR RESEARCH USE ONLY (PR76834)
-
Page 2: Table Of Contents
Advantage-HF cDNA Polymerase Mix is covered by U.S. Patent No. 5,436,149. Foreign patents pending. TaqStart Antibodies are licensed under U.S. Patent No. 5,338,671 and corresponding patents in other countries. page Protocol # PT3139-1 Technical Support TEL:415-424-8222 or 800-662-CLON Version # PR76834... -
Page 3: Introduction
Advantage-HF PCR Kit offers Pfu -like fidelity combined with the efficiency required to amplify DNA fragments of up to 2.5 kb. These benefits are the result of reformulation of several components in CLONTECH’s Advantage PCR Enzyme Systems. The Advantage-HF Polymerase Mix combines KlenTaq (a 5'-... - Page 4 & 6: 2.5-kb fragment of lactoferrin gene. Cycling parameters: 30 sec at 94 C; 30 x (30 sec at 94 5 min at 68 C); 5 min at 68 page Protocol # PT3139-1 Technical Support TEL:415-424-8222 or 800-662-CLON Version # PR76834 FAX: 415-424-1064 or 800-424-1350...
- Page 5 (A) and amplification (B) of a 6.0-kb cDNA ments should be determined in- fragment from Human Placenta cDNA. Size markers are λ/ Hin d III DNA. dividually. TEL:415-424-8222 or 800-662-CLON Technical Support Protocol # PT3139-1 page FAX:415-424-1064 or 800-424-1350 Version # PR76834...
- Page 6 DNA synthesis from nonspecifically primed sites prior to the onset of thermal cycling. The advantages of hot start PCR have been demonstrated in many different applications. However, only CLONTECH's Advantage Polymerase Mixes provide automatic hot start.
-
Page 7: List Of Components
Control DNA template λ DNA (0.2 ng/µl) µ µ l Control primer mix (10 µM each) • The sequences are: 5' primer 5'–TTGGTTGATCGTGGTGCAGAGAACGTTG–3' 3' primer 5'–GAGAAGGTCACGAATGAACCAGGCGATAA–3' TEL:415-424-8222 or 800-662-CLON Technical Support Protocol # PT3139-1 page FAX:415-424-1064 or 800-424-1350 Version # PR76834... -
Page 8: Additional Materials Required
Do not autoclave pipette tips. • DNA size markers (See Section IV.D) • 5X Stop/loading buffer (Sambrook et al. [1989] provides several recipes.) page Protocol # PT3139-1 Technical Support TEL:415-424-8222 or 800-662-CLON Version # PR76834 FAX: 415-424-1064 or 800-424-1350... -
Page 9: Advantage-Hf Pcr Kit Protocol
RT-PCR protocols, incomplete reverse transcription can lead to an absence of product, shorter than full-length products, or smearing. For 5' and 3' RACE and general PCR from cDNA, you can ensure the quality of your cDNA by using Marathon-Ready cDNA from CLONTECH. TEL:415-424-8222 or 800-662-CLON Technical Support... - Page 10 Do not use a manual hot start or wax-bead-based hot start when using Advantage-HF. As discussed in the Introduction, hot start is automatic with Advantage-HF because the enzyme mix already contains TaqStart Antibody. page Protocol # PT3139-1 Technical Support TEL:415-424-8222 or 800-662-CLON Version # PR76834 FAX: 415-424-1064 or 800-424-1350...
-
Page 11: Control Pcr Reactions
2 kb. No bands should be generated in the negative (i.e., no DNA template) control. TEL:415-424-8222 or 800-662-CLON Technical Support Protocol # PT3139-1 page FAX:415-424-1064 or 800-424-1350 Version # PR76834... -
Page 12: Recommended Cycling Parameters
Some researchers prefer to use an annealing/extension time equal to the expected target size plus two minutes. Optional: This final extension may reduce background in some cases. page Protocol # PT3139-1 Technical Support TEL:415-424-8222 or 800-662-CLON Version # PR76834 FAX: 415-424-1064 or 800-424-1350... -
Page 13: Amplification Of Longer Fragments With The Advantage Buffer
Recommended insert size range % agarose DNA size markers φX174/ Hae III 0.3–1.5 kb 0.5–10 kb 1-kb DNA ladder λ/ Hin d III >5 kb TEL:415-424-8222 or 800-662-CLON Technical Support Protocol # PT3139-1 page FAX:415-424-1064 or 800-424-1350 Version # PR76834... -
Page 14: Troubleshooting Guide
Advantage-HF Kit can be used. When using the kit with another CLONTECH product, additional, application-specific troubleshooting information can be found in the relevant User Manual. - Page 15 22 nt long, try using a longer primer. If the original primer(s) had a GC content of less than 45%, try to design a primer with a GC content of 45–60%. TEL:415-424-8222 or 800-662-CLON Technical Support Protocol # PT3139-1 page FAX:415-424-1064 or 800-424-1350 Version # PR76834...
- Page 16 Altering the concentration of Mg result in lower fidelity. Too much template Try a lower concentration of DNA template in the PCR reaction. Contamination See Section D below. page Protocol # PT3139-1 Technical Support TEL:415-424-8222 or 800-662-CLON Version # PR76834 FAX: 415-424-1064 or 800-424-1350...
- Page 17 (UNG). When performing PCR directly on phage plaques or bacterial colonies, failure to isolate single plaques or colonies will also produce multiple bands. TEL:415-424-8222 or 800-662-CLON Technical Support Protocol # PT3139-1 page FAX:415-424-1064 or 800-424-1350 Version # PR76834...
-
Page 18: References
Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual, Second Edition (Cold Spring Harbor Laboratory, Cold Spring Harbor, NY). page Protocol # PT3139-1 Technical Support TEL:415-424-8222 or 800-662-CLON Version # PR76834 FAX: 415-424-1064 or 800-424-1350... -
Page 19: Related Products
TthStart Antibody #5401-1 • PRIMER PREMIER many • Poly A many • Multiple Tissue Northern (MTN ) Blots many • UltraPure PCR Deoxynucleotide Mix #4700-1 TEL:415-424-8222 or 800-662-CLON Technical Support Protocol # PT3139-1 page FAX:415-424-1064 or 800-424-1350 Version # PR76834... - Page 20 Delta , Marathon-Ready , TaqStart , and TthStart are trademarks of CLONTECH Laboratories, Inc. GeneAmp is a trademark of Hoffmann-La Roche, Inc. Deep Vent is a trademark of New England Biolabs, Inc. © 1997, CLONTECH Laboratories, Inc. All rights reserved.
Need help?
Do you have a question about the PT3139-1 and is the answer not in the manual?
Questions and answers